costakaylatr2008
costakaylatr2008
03-03-2022
Mathematics
contestada
whats 348.69 simplified
Respuesta :
lawrencemma2165
lawrencemma2165
03-03-2022
A simplified answer depends on the placement to where the decimal is going, so technically this can simplify in all of the following way considering the amount of digits to round it to.
300, 350, 349, 348.7 respectively
Answer Link
VER TODAS LAS RESPUESTAS ( 82+ )
Otras preguntas
6. Rewrite each of the following durations using eighth notes. Write in words and as a fraction: a. 1 quarter note b. 1 half note c. 1 full note
If 100 kg of cucumbers are 99% water, how much do they weigh if they are 97% water?
The reason why vanessa did not include sports skills activities in her program was that she:
Which statement describes a main difference between CPR performed on adults and CPR performed on infants? a) For adults only, alternate between compressions a
Between 1920 and 1930, almost a million african american's left the south for the "promised land" up north during the
The substance in the digestive system that lubricates moistens and protects the surface of the lumen is
As a result of the educational reforms enacted in 1984, Texas schools offered A. lighter class loads. B. smaller class sizes. C. fewer assessment tests. D
Somebody asked a teacher: ”How many students do you have? I would like to send my son to your school.” The teacher answered: “If as many students as I have now
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
With this sole proprietorship, who pays the taxes?
